WebQTL
 
   |    Home    |    Search    |    Help    |    News    |    References    |    Policies    |    Links    |    Welcome! Login   

Probe Information

The table below lists information of all probes of probe set TC0900002327.mm.1 from database EPFL/LISP BXD CD+HFD ScWAT Affy MTA 1.0 GeneLevel Main (Feb16) RMA **.

QTL Heat Map and ClusteringCorrelation Matrix and PCA

Probe1
sortup.gifsortdown.gif
Sequence2
sortup.gifsortdown.gif
bl2seq3Exons4Tm °C5
sortup.gifsortdown.gif
Stacking Energy KBT6Mean7
sortup.gifsortdown.gif
Stdev8
sortup.gifsortdown.gif
Probe h29
sortup.gifsortdown.gif
Probe Location10SNPs
(Across all strains)
11
SNPs
(Different alleles only between C57BL/6J and DBA/2J)
11
GSB
sortup.gifsortdown.gif
NSB
sortup.gifsortdown.gif
ChrStartEnd
1 5518536CACCGAAGCACAGCTAAGCTAGCAC
2 590418CAGCAGTACACAGAACCTGGGTACT
3 6448734CTAGCACGGAGAGCGCGGGGTTCCT
4 1063704GGCTTGGTTATCATATCGTAGGAGC
5 1522868AATCATCTTGAATCTCTTTGGCTAC
6 1971642GACATAGACACCTCAAACTGGATGA
7 2540524GAAGCCGAGGTCGTGCACATTCAGT
8 3568286ATAAGGCAGAAGACTCCCCTAGAAC
9 4219922TCTTCAAACAGGTACTGGAACAGGC
10 4874397TCTGTAGTGCACGTTGAGCACAAAG
11 5641047CACCCATGTCTGAAGACCGCATGGA
12 6089731CCTTGGTAGTCAGAGGGTTTCCATT
13 6735295GTTGGTTTCCATGATCTGGTTTACT
14 1303990GTTTACTTCATCCACCTTCACCAGC
15 170302ATGCACACCAGGATGAAAACCCAGA
16 2262175CTCTCTCCAGGTTGTAGCTTGTCTG
17 2961437GATCACATAATGAAGAAGCAGCGTG
18 3961309GTAGTCATTCCAGATTTGCTTCAGC
19 445598CAGAGAAAAATGCGATCAATCACCA
20 5180706CCGAGGCGCTGGCCACTGGCAGCAG
21 5438794GCGAATGTATAGCGAGTACGTGATG
22 5857777AAGCACGATGTCTGGTTTCCAGATC
23 6382461TTTCCATGATCTGGTTTACTTCATC
24 935054CCTTGGCGAACAGGTCACAGTTTAT
25 1477941TGTGTGGTCGGAGTTCTGTAGTGCA
26 1950777AGGTGACTGACCAAAATAAGGCAGA
27 2528858CCTATGCATCACTGCACAAGGAAGC
28 3381114CACGTGGTGACGCACTGGAAGGTAT
29 4211076ATATCGTAGGAGCCAAGATGCCTAC
30 4831609CAGGAGTAGTGTCCAGTCCAGTTCC
31 5631284AGCAGACTGTAATGATGCACAGCCA
32 6012249GGCAGAAGACTCCCCTAGAACCCCA
33 6680320TCCCCATCGGCGTTGTTGTAAAGCA
34 1209094TCTGGCCATCAAGGGTTGCAGAAAT
35 1654459TCAAAGGCTTGAGCCACAACACCCA
36 2154265GGCACATCGTGTGGCCCCAGCACTT
37 2919266TTCTGCTTCACTCGCCAGCCATCCT
38 381476AGTCTAATTTTCTAACCTCTGCCCT
39 4362303TGTAAAGCACGATGTCTGGTTTCCA
40 5165132TGACAGGTGACTGACCAAAATAAGG
41 5789137GAGAGCGCGGGGTTCCTCCCGGCTT
42 6339762TTGCTTCAGCCACAGGTTGGTTTCC
43 768455TGCAGAAATAATCCTGCAGTTCCTA
44 1463758GGTTTCCATGATCTGGTTTACTTCA
45 1856139CAGGGGCACATCGTGTGGCCCCAGC
46 2381407GCAAACTCCAAGCAGTGATCGGATA
47 329934GACCGCATGGACAGGACCGGAGCCA
48 4127990TTCTAACCTCTGCCCTATGCATCAC
49 4677341CCCGGGTCCAGGAGTAGTGTCCAGT
50 5430264ATCGGCTGCCGAAGTCCACACATCT
51 554124TCTGTGGACTCTAGGAGTTGTGGTT
52 5970429AGGTAGAAGACGAGCACAGTGAGGA
53 6606269AACCTCTGCCCTATGCATCACTGCA
54 1127165ATGAGCAGGCACGGAATGATGAGGT
55 164023GGTTGGTTTCCATGATCTGGTTTAC
56 2016652AGACTCCTTGATGTCAATACTTTTA
57 2822568GATTGAAGTTGACAGGTGACTGACC
58 3761959CCCACAAGAGTCTAATTTTCTAACC
59 4247602TTGAGAGCTCAGCACCGTAGAAGTT
60 5000233TGTGAGGTTGGCACTGAAATTTGAG
61 5686672CTCAAGAGCAGTCAGGTGACCCTGT
62 6315564AACTGGATGATGACAGGATGGGACA
63 6847128CTGCAGTTCCTAAAATGCACACCAG
64 1391450ATCTGTTCCAAACGTGAAATAAGCC
65 1797370AGTCATTCCAGATTTGCTTCAGCCA
66 2365592AGACATATTGGCTCAAGCTGTCTGC
67 3152014ATGACTCCCTGCAGCTCGCGTGTGA
68 4066504CATTCCAGATTTGCTTCAGCCACAG
69 4477861AGGCGCTGGCCACTGGCAGCAGCAT
70 5225364GAGCTTCAATTTAGGCTTGACACAG
71 5526440CATCTTGAATCTCTTTGGCTACATT
72 5929938ATCACTGCACAAGGAAGCCATAATA
73 6499763TGGAACAGGCGGTGCTCAGCTTCCG
74 1098282ATCATCTTGAATCTCTTTGGCTACA
75 1571739ATTGCTGGGCAATCTGCCCCACCCC
76 1974775CTGGTTTACTTCATCCACCTTCACC
77 262579GAAAAATGCGATCAATCACCATGGC
78 3666530GCAGACATAATGGCTGATGGTACAG
79 4229390TCTCTCATCCCAACTCGAGTCGGGA
80 4934362GTTTCCATGATCTGGTTTACTTCAT
81 5647390AGAAACCACAATTGCGCTGAGAGAG
82 615153TCTATTTGAATTCATGAGATGTGTC
83 6794520ATCCCCATCGGCGTTGTTGTAAAGC
84 1344785ATCTAATGCCGGTCATAAGGCTGAG
85 1707877TGAAGACCGCATGGACAGGACCGGA
86 2269119GAAGCTGTGTGCGCTTAGGCTAGTA
87 3008709TGGTTTCCATGATCTGGTTTACTTC
88 3980641GAGGCGCTGGCCACTGGCAGCAGCA
89 446742ATGAACTCCACCCCTTGGTAGTCAG
90 5187272ACTCAGGTCCACAACCTGAGTCTTA
91 5489879AAATCCCCATCGGCGTTGTTGTAAA
92 5887138TCGCATGAACTCCACCCCTTGGTAG
93 6405243ATGTCTGAAGACCGCATGGACAGGA
94 987328ACCCCAGGGGCACATCGTGTGGCCC
95 1490001AACCCAGAGAAAAATGCGATCAATC
96 1961208TACTAACAATGAGTGTGAGACCAGG
97 2537435GGACTCGCATGAACTCCACCCCTTG
98 340016AAGACTGTGATGACGATGGACAAGG
99 4214433CCAATCATCTTGAATCTCTTTGGCT
100 4835283CGAGCTCCCGCGCACTTGCGCGCCC
101 5637603TTAAACTGCCCACCTTACCAAATGA
102 60386GAAGTTGACAGGTGACTGACCAAAA
103 6709928GCGGCGGGGGCAGCACAACACCCAT
104 1268784GCTAGTCTCGAGCCTCAGCTAACTA
105 1672704TGCCCCACCCCACAAGAGTCTAATT
106 2191752CAGTCAGGTGACCCTGTCCCGGGTC
107 2943448CTCCCTTGGTATCAATGTCCTCATC
108 3873351GCCACAGGTTGGTTTCCATGATCTG
109 4444996TAGAACCCCAGGGGCACATCGTGTG
110 5171830CTGAGTCTTACACATCCCTCTATAG
111 5855569TCCTAATGCCCTGTTTGACATAGTG
112 6346198ACTTGCGCGCCCGAGTGCACGAACC
113 913064GTGTGAACCTACCGTGCAATGCTGT
114 1476586GAGACTAATGTCCCTCTACATAGCT
115 1924872AGTTTGTATCCTTACCAAGAGCAGC
116 2445858GAGTGCACGAACCCCAGGCAGGCAA
117 3364805ATGGTCTCGGTGATCACGAGGAGAA
118 4151487ACAACACCCATGTCTGAAGACCGCA
119 4711365GGTTTACTTCATCCACCTTCACCAG
120 5436953ACTCCACCCCTTGGTAGTCAGAGGG
121 5626920CCCATCGGCGTTGTTGTAAAGCACG
122 6002209ACACGTTAGCCACCGGCCGGATGAT
123 6617074GCGGTGCTCAGCTTCCGAGGCGCTG
124 1183905TTCAGCCACAGGTTGGTTTCCATGA
125 1643978GAGGTAACTAATCTACCCAAGGGCA
126 2029874AGCCAATGAGGACCAGGTCGATCTT
127 2847984CGTTGTAATCTTCAAACAGGTACTG
128 3809178AGGCACACAGGCCTGTTATTGGCAT
129 4335708GAAGCAGCGTGTAATTCTGTGATTC
130 5143843GAACCCCAGGCAGGCAAGCGCTGCT
131 5704552CAGCATCAGCATGGACAGCGGCGGC
132 631612ATCAGCATGGACAGCGGCGGCGGGG
133 6864436CAGTTGTGGCCAAGTTAGAATCCTA
134 1441742GCATGGACAGGACCGGAGCCACTCT
135 1840210TTGTTGTAAAGCACGATGTCTGGTT
136 2374504GATCACGTCGAAGGTCTCTAGGCAA
137 3282530AGGTTGGTTTCCATGATCTGGTTTA
138 4091106CTGTCCCGGGTCCAGGAGTAGTGTC
139 4519423ACAAGGAAGCCATAATAAAAACCAT
140 532144TCTGCCCTATGCATCACTGCACAAG
141 5537878GTGTCTATAAGCACTCAGGTCCACA
142 5939651GCGCTGGCCACTGGCAGCAGCATCA
143 6582286TGGCAACATACTTCCAATCATCTTG
144 1107505TGCTCAGCTTCCGAGGCGCTGGCCA
145 1611153TTACTTCATCCACCTTCACCAGCTG
146 2012929GATTCTAATTTCCGTGTAACATCTG
147 278834ACAGCTAAGCTAGCACGGAGAGCGC
148 3692590CTGACCACCACCGAAGCACAGCTAA
149 4239301GCCGGATGATCTCGTTGTAATCTTC
150 4936926CAGGTCACAGTTTATGTGTCATCTC
151 5657626TCTCTGCAGGGACTCGCATGAACTC
152 6163193AGCAACAAATAAGGCAATCACCACC
153 6794997ATAAGCCCATCGGGCAAGCCTAACA
154 1372940GACAGGATGGGACACGTTAGCCACC
155 1750069GTCATTCCAGATTTGCTTCAGCCAC
156 2310126CCCGGCTTCGCGCCGCCGAGCTCCC
157 3120487GGCAGCACAACACCCATGTCTGAAG
158 4050897TGCAGGGACTCGCATGAACTCCACC
159 4475332CATCCTCAGTTGTACAGCCAGACAG
160 5193179CACCTTGATCCTAGACGTCTCAAGC

CITG Web services initiated January, 1994 as Portable Dictionary of the Mouse Genome; June 15, 2001 as WebQTL; and Jan 5, 2005 as GeneNetwork. This site is currently operated by Rob Williams, Pjotr Prins, Zachary Sloan, Arthur Centeno. Design and code by Pjotr Prins, Zach Sloan, Arthur Centeno, Danny Arends, Christian Fischer, Sam Ockman, Lei Yan, Xiaodong Zhou, Christian Fernandez, Ning Liu, Rudi Alberts, Elissa Chesler, Sujoy Roy, Evan G. Williams, Alexander G. Williams, Kenneth Manly, Jintao Wang, and Robert W. Williams, colleagues. Python Powered Registered with Nif
GeneNetwork support from:
  • The UT Center for Integrative and Translational Genomics
  • NIGMS Systems Genetics and Precision Medicine project (R01 GM123489, 2017-2021)
  • NIDA NIDA Core Center of Excellence in Transcriptomics, Systems Genetics, and the Addictome (P30 DA044223, 2017-2022)
  • NIA Translational Systems Genetics of Mitochondria, Metabolism, and Aging (R01AG043930, 2013-2018)
  • NIAAA Integrative Neuroscience Initiative on Alcoholism (U01 AA016662, U01 AA013499, U24 AA013513, U01 AA014425, 2006-2017)
  • NIDA, NIMH, and NIAAA (P20-DA 21131, 2001-2012)
  • NCI MMHCC (U01CA105417), NCRR, BIRN, (U24 RR021760)
    Join GeneNetwork Mailing List
    It took 0.591 second(s) for lily.uthsc.edu to generate this page