WebQTL
 
   |    Home    |    Search    |    Help    |    News    |    References    |    Policies    |    Links    |    Welcome! Login   

Probe Information

The table below lists information of all probes of probe set 1452010_at_A from database GSE16780 UCLA Mouse BXH Liver Affy HT M430A (Sep11) RMA.

QTL Heat Map and ClusteringCorrelation Matrix and PCA

Probe1
sortup.gifsortdown.gif
Sequence2
sortup.gifsortdown.gif
bl2seq3Exons4Tm °C5
sortup.gifsortdown.gif
Stacking Energy KBT6Mean7
sortup.gifsortdown.gif
Stdev8
sortup.gifsortdown.gif
Probe h29
sortup.gifsortdown.gif
Probe Location10SNPs
(Across all strains)
11
SNPs
(Different alleles only between C57BL/6J and C3H/HeJ)
11
GSB
sortup.gifsortdown.gif
NSB
sortup.gifsortdown.gif
ChrStartEnd
1 543315GCTATTGCCACCACCGTAGGGTAAA 584.08-0.7985.724954.81343154.813455
2 543316GCTATTGCCACCTCCGTAGGGTAAA
3 X48Y13ATTTCAGTGCCAACCTCACAAGAAG 580.99-0.2765.573954.81339854.813422wt37-9-54813399
MRS2727281
MRS2727281
4 X48Y14ATTTCAGTGCCATCCTCACAAGAAG
5 X12351GAAGCTCCAGTTCTGAGTCTGTTGA 581.5-0.8755.501954.81337754.813401wt37-9-54813399
MRS2727281
MRS2727281
6 X12352GAAGCTCCAGTTGTGAGTCTGTTGA
7 704427GTTGATGCTGTGTTGTCCCTGTCTG 583.04-1.9223.813954.81335754.813381
8 704428GTTGATGCTGTGATGTCCCTGTCTG
9 318267CTGTCTGCTCTGTCACCAGAAATCA 581.78-0.9124.249954.81333954.813363
10 318268CTGTCTGCTCTGACACCAGAAATCA
11 418429GTTGCCATGGTGATTGATCGCATTT 682.0-0.4777.156954.81102154.811045
12 418430GTTGCCATGGTGTTTGATCGCATTT
13 129705TTGATCGCATTTTTCTCTGGGTTTT 679.26-0.1747.224954.81100854.811032
14 129706TTGATCGCATTTATCTCTGGGTTTT
15 X61507GGTTTTCATCCTGGTGTGCATTTTA 679.52-1.1245.149954.81098954.811013wt37-9-54811004
16 X61508GGTTTTCATCCTCGTGTGCATTTTA
17 655507GGATTATTTCTGCAACCCTTGATGG 679.43-0.5216.119954.81095554.810979
18 655508GGATTATTTCTGGAACCCTTGATGG
19 704493GGGTTATTTTCCACTCATCTTGATC 676.81-1.0365.924954.81080954.810833wt37-9-54810814
MRS2727234
MRS2727234
20 704494GGGTTATTTTCCTCTCATCTTGATC
21 345205AATGAACATTTCACTATCCCCATGA 77.92-0.6397.351954.8107254.810744
22 345206AATGAACATTTCTCTATCCCCATGA

CITG Web services initiated January, 1994 as Portable Dictionary of the Mouse Genome; June 15, 2001 as WebQTL; and Jan 5, 2005 as GeneNetwork. This site is currently operated by Rob Williams, Pjotr Prins, Zachary Sloan, Arthur Centeno. Design and code by Pjotr Prins, Zach Sloan, Arthur Centeno, Danny Arends, Christian Fischer, Sam Ockman, Lei Yan, Xiaodong Zhou, Christian Fernandez, Ning Liu, Rudi Alberts, Elissa Chesler, Sujoy Roy, Evan G. Williams, Alexander G. Williams, Kenneth Manly, Jintao Wang, and Robert W. Williams, colleagues. Python Powered Registered with Nif
GeneNetwork support from:
  • The UT Center for Integrative and Translational Genomics
  • NIGMS Systems Genetics and Precision Medicine project (R01 GM123489, 2017-2021)
  • NIDA NIDA Core Center of Excellence in Transcriptomics, Systems Genetics, and the Addictome (P30 DA044223, 2017-2022)
  • NIA Translational Systems Genetics of Mitochondria, Metabolism, and Aging (R01AG043930, 2013-2018)
  • NIAAA Integrative Neuroscience Initiative on Alcoholism (U01 AA016662, U01 AA013499, U24 AA013513, U01 AA014425, 2006-2017)
  • NIDA, NIMH, and NIAAA (P20-DA 21131, 2001-2012)
  • NCI MMHCC (U01CA105417), NCRR, BIRN, (U24 RR021760)
    Join GeneNetwork Mailing List
    It took 0.071 second(s) for lily.uthsc.edu to generate this page