WebQTL
 
   |    Home    |    Search    |    Help    |    News    |    References    |    Policies    |    Links    |    Welcome! Login   

Probe Information

The table below lists information of all probes of probe set 1369001_at from database MDC/CAS/UCL Liver (Dec08) RMA.

QTL Heat Map and ClusteringCorrelation Matrix and PCA

Probe1
sortup.gifsortdown.gif
Sequence2
sortup.gifsortdown.gif
bl2seq3Exons4Tm °C5
sortup.gifsortdown.gif
Stacking Energy KBT6Mean7
sortup.gifsortdown.gif
Stdev8
sortup.gifsortdown.gif
Probe h29
sortup.gifsortdown.gif
Probe Location10SNPs
(Across all strains)
11
SNPs
(Different alleles only between BN-Lx/Cub and SHR/OlaIpcv)
11
GSB
sortup.gifsortdown.gif
NSB
sortup.gifsortdown.gif
ChrStartEnd
1 166Y25ATCTCAAATTTCAGTGCCAACCTCA
2 235Y33ATCTCAAATTTCAGTGCCAACCTCA
3 166Y26ATCTCAAATTTCTGTGCCAACCTCA
4 235Y34ATCTCAAATTTCTGTGCCAACCTCA
5 574Y71AGTTCTGAGTCTGTCAACGCTGTGT
6 696Y93AGTTCTGAGTCTGTCAACGCTGTGT
7 696Y94AGTTCTGAGTCTCTCAACGCTGTGT
8 574Y72AGTTCTGAGTCTCTCAACGCTGTGT
9 473363GTTGCCATGGTGATTGATCGCATCT
10 767499GTTGCCATGGTGATTGATCGCATCT
11 767500GTTGCCATGGTGTTTGATCGCATCT
12 473364GTTGCCATGGTGTTTGATCGCATCT
13 660667TGATCGCATCTTTCTCTGGGTTTTC
14 361487TGATCGCATCTTTCTCTGGGTTTTC
15 361488TGATCGCATCTTACTCTGGGTTTTC
16 660668TGATCGCATCTTACTCTGGGTTTTC
17 775597GGTTTTCATCCTGGTGTGCATTTTA
18 X41435GGTTTTCATCCTGGTGTGCATTTTA
19 775598GGTTTTCATCCTCGTGTGCATTTTA
20 X41436GGTTTTCATCCTCGTGTGCATTTTA
21 596405GAACGGCGGGATTATTTCTGCAACC
22 394293GAACGGCGGGATTATTTCTGCAACC
23 394294GAACGGCGGGATAATTTCTGCAACC
24 596406GAACGGCGGGATAATTTCTGCAACC
25 144691TGCAACCCTTGATGGCCAGAGATGA
26 X89503TGCAACCCTTGATGGCCAGAGATGA
27 144692TGCAACCCTTGAAGGCCAGAGATGA
28 X89504TGCAACCCTTGAAGGCCAGAGATGA
29 584Y21ATAGACTGTGCACTGTTCATCGAGG
30 347Y17ATAGACTGTGCACTGTTCATCGAGG
31 347Y18ATAGACTGTGCAGTGTTCATCGAGG
32 584Y22ATAGACTGTGCAGTGTTCATCGAGG
33 509413GGGCCACTTCCTCAATAGCACTATA
34 X18569GGGCCACTTCCTCAATAGCACTATA
35 509414GGGCCACTTCCTGAATAGCACTATA
36 X18570GGGCCACTTCCTGAATAGCACTATA
37 318161ACTTTATCTGATCACTGGCTTGGAG
38 412121ACTTTATCTGATCACTGGCTTGGAG
39 318162ACTTTATCTGATGACTGGCTTGGAG
40 412122ACTTTATCTGATGACTGGCTTGGAG
41 577181AATGAACATTTCACTACCCCTGTGA
42 777245AATGAACATTTCACTACCCCTGTGA
43 577182AATGAACATTTCTCTACCCCTGTGA
44 777246AATGAACATTTCTCTACCCCTGTGA

CITG Web services initiated January, 1994 as Portable Dictionary of the Mouse Genome; June 15, 2001 as WebQTL; and Jan 5, 2005 as GeneNetwork. This site is currently operated by Rob Williams, Pjotr Prins, Zachary Sloan, Arthur Centeno. Design and code by Pjotr Prins, Zach Sloan, Arthur Centeno, Danny Arends, Christian Fischer, Sam Ockman, Lei Yan, Xiaodong Zhou, Christian Fernandez, Ning Liu, Rudi Alberts, Elissa Chesler, Sujoy Roy, Evan G. Williams, Alexander G. Williams, Kenneth Manly, Jintao Wang, and Robert W. Williams, colleagues. Python Powered Registered with Nif
GeneNetwork support from:
  • The UT Center for Integrative and Translational Genomics
  • NIGMS Systems Genetics and Precision Medicine project (R01 GM123489, 2017-2021)
  • NIDA NIDA Core Center of Excellence in Transcriptomics, Systems Genetics, and the Addictome (P30 DA044223, 2017-2022)
  • NIA Translational Systems Genetics of Mitochondria, Metabolism, and Aging (R01AG043930, 2013-2018)
  • NIAAA Integrative Neuroscience Initiative on Alcoholism (U01 AA016662, U01 AA013499, U24 AA013513, U01 AA014425, 2006-2017)
  • NIDA, NIMH, and NIAAA (P20-DA 21131, 2001-2012)
  • NCI MMHCC (U01CA105417), NCRR, BIRN, (U24 RR021760)
    Join GeneNetwork Mailing List
    It took 0.797 second(s) for lily.uthsc.edu to generate this page