WebQTL
 
   |    Home    |    Search    |    Help    |    News    |    References    |    Policies    |    Links    |    Welcome! Login   

Probe Information

The table below lists information of all probes of probe set 1455931_at_A from database (B6 x BTBR)F2-ob/ob Liver mRNA M430 Probe (Jul04).

QTL Heat Map and ClusteringCorrelation Matrix and PCA

Probe1
sortup.gifsortdown.gif
Sequence2
sortup.gifsortdown.gif
bl2seq3Exons4Tm °C5
sortup.gifsortdown.gif
Stacking Energy KBT6Mean7
sortup.gifsortdown.gif
Stdev8
sortup.gifsortdown.gif
Probe h29
sortup.gifsortdown.gif
Probe Location10SNPs
(Across all strains)
11
SNPs
(Different alleles only between C57BL/6J and BTBRT<+>tf/J)
11
GSB
sortup.gifsortdown.gif
NSB
sortup.gifsortdown.gif
ChrStartEnd
1 X66375GACGTCTAGGATCAAGGTGCCAGCA 85.470.0988.6175.960.24954.81020654.81023wt37-9-54810224
MRS2727226
wt37-9-54810224
MRS2727226
2 X66376GACGTCTAGGATGAAGGTGCCAGCA5.910.20
3 378Y23ATAAAGCATACCTTCCAGTGCGTCA 81.77-0.456.9268.250.26954.81015554.810179wt37-9-54810175
wt37-9-54810175
4 378Y24ATAAAGCATACCATCCAGTGCGTCA7.150.22
5 411235CAGTGCGTCACCACGTGGCTGAAAG 87.06-0.9316.1539.080.41954.8101454.810164wt37-9-54810140
wt37-9-54810148
wt37-9-54810150
wt37-9-54810140
wt37-9-54810148
wt37-9-54810150
6 411236CAGTGCGTCACCTCGTGGCTGAAAG10.360.31
7 109287CCTTTGTCAAGGCATGCCCTCATGA 84.91-0.626.0798.630.23954.81008954.810113wt37-9-54810111
wt37-9-54810112
wt37-9-54810111
wt37-9-54810112
8 109288CCTTTGTCAAGGGATGCCCTCATGA8.580.24
9 607577TGACCTCCCAAACAGCATTGCACGG 87.06-0.2496.09110.160.39954.81005954.810083wt37-9-54810064
wt37-9-54810064
10 607578TGACCTCCCAAAGAGCATTGCACGG9.100.43
11 107245CATTGCACGGTAGGTTCACACGCGA 86.48-0.0248.7185.960.21954.81004454.810068wt37-9-54810051
MRS2727222
wt37-9-54810064
wt37-9-54810051
MRS2727222
wt37-9-54810064
12 107246CATTGCACGGTACGTTCACACGCGA6.050.22
13 237687TTCACACGCGAGCTGCAGGGAGTCA 89.460.4758.7525.770.24954.8100354.810054wt37-9-54810041
wt37-9-54810051
MRS2727222
wt37-9-54810041
wt37-9-54810051
MRS2727222
14 237688TTCACACGCGAGGTGCAGGGAGTCA5.870.21
15 592235CAGGGAGTCATCCAGACCCTAGGAT 84.28-0.9796.3567.810.18954.81001554.810039wt37-9-54810027
MRS2727221
wt37-9-54810027
MRS2727221
16 592236CAGGGAGTCATCGAGACCCTAGGAT6.320.18
17 315655TAGGGTTTGTGCTCCCGACTCGAGT 86.63-1.5234.20411.240.22954.80996154.809985
18 315656TAGGGTTTGTGCACCCGACTCGAGT8.970.30
19 177575TGAGTTTCCCATATTACATTTCCAA 75.97-0.5377.1826.510.24954.80978954.809813wt37-9-54809809
wt37-9-54809809
20 177576TGAGTTTCCCATTTTACATTTCCAA6.870.28
21 195465GTCCACAGAGACCATTTTGAGTATT 78.080.1858.6326.370.31954.80974354.809767wt37-9-54809760
wt37-9-54809760
22 195466GTCCACAGAGACGATTTTGAGTATT5.830.24

CITG Web services initiated January, 1994 as Portable Dictionary of the Mouse Genome; June 15, 2001 as WebQTL; and Jan 5, 2005 as GeneNetwork. This site is currently operated by Rob Williams, Pjotr Prins, Zachary Sloan, Arthur Centeno. Design and code by Pjotr Prins, Zach Sloan, Arthur Centeno, Danny Arends, Christian Fischer, Sam Ockman, Lei Yan, Xiaodong Zhou, Christian Fernandez, Ning Liu, Rudi Alberts, Elissa Chesler, Sujoy Roy, Evan G. Williams, Alexander G. Williams, Kenneth Manly, Jintao Wang, and Robert W. Williams, colleagues. Python Powered Registered with Nif
GeneNetwork support from:
  • The UT Center for Integrative and Translational Genomics
  • NIGMS Systems Genetics and Precision Medicine project (R01 GM123489, 2017-2021)
  • NIDA NIDA Core Center of Excellence in Transcriptomics, Systems Genetics, and the Addictome (P30 DA044223, 2017-2022)
  • NIA Translational Systems Genetics of Mitochondria, Metabolism, and Aging (R01AG043930, 2013-2018)
  • NIAAA Integrative Neuroscience Initiative on Alcoholism (U01 AA016662, U01 AA013499, U24 AA013513, U01 AA014425, 2006-2017)
  • NIDA, NIMH, and NIAAA (P20-DA 21131, 2001-2012)
  • NCI MMHCC (U01CA105417), NCRR, BIRN, (U24 RR021760)
    Join GeneNetwork Mailing List
    It took 0.099 second(s) for lily.uthsc.edu to generate this page