|    Home    |    Search    |    Help    |    News    |    References    |    Policies    |    Links    |    Welcome! Login   

Probe Information

The table below lists information of all probes of probe set 1444368_at from database Stuart Spleen M430v2 (Nov07) RMA.

QTL Heat Map and ClusteringCorrelation Matrix and PCA

bl2seq3Exons4Tm °C5
Stacking Energy KBT6Mean7
Probe h29
Probe Location10SNPs
(Across all strains)
(Different alleles only between C57BL/6ByJ and BALB/cByJ)
1 606523GACTGAGCCTGTTAGATAAGCATCC 79.91954.8212654.821284wt37-9-54821264
3 482267AAGTAAGCTAAGTCTCTACCCCACA 80.22954.82123154.821255wt37-9-54821238
5 X89563GAGGATGTCTTCCATGATCAGTCAT 79.4954.82110454.821128
7 303597GTTGAAGCAAGGCATCTCACTGAGC 83.28954.82106954.821093
9 954533GAGCCTAGAGCTCAATGATTCTGTT 79.72954.82104854.821072
11 865917TAGGGAGCCATCTTACCGCAGCGAT 86.91954.82101954.821043wt37-9-54821039
13 988329CAGGGATTCCATCTCTGCTGAGGAT 83.27954.82094854.820972
15 X67563GAGGATGCTCACACTTATGCAACAA 80.74954.82092954.820953
17 928817TGCAACAAATCCCTTAGTCACTGAC 80.49954.82091254.820936
19 983173ACGGTCTCATAGTGCATGGCCTAGG 85.27954.82086754.820891
21 540729GGACTCCCTATGTAGCTTAAGCTGG 81.39954.82084454.820868

CITG Web services initiated January, 1994 as Portable Dictionary of the Mouse Genome; June 15, 2001 as WebQTL; and Jan 5, 2005 as GeneNetwork. This site is currently operated by Rob Williams, Pjotr Prins, Zachary Sloan, Arthur Centeno. Design and code by Pjotr Prins, Zach Sloan, Arthur Centeno, Danny Arends, Christian Fischer, Sam Ockman, Lei Yan, Xiaodong Zhou, Christian Fernandez, Ning Liu, Rudi Alberts, Elissa Chesler, Sujoy Roy, Evan G. Williams, Alexander G. Williams, Kenneth Manly, Jintao Wang, and Robert W. Williams, colleagues. Python Powered Registered with Nif
GeneNetwork support from:
  • The UT Center for Integrative and Translational Genomics
  • NIGMS Systems Genetics and Precision Medicine project (R01 GM123489, 2017-2021)
  • NIDA NIDA Core Center of Excellence in Transcriptomics, Systems Genetics, and the Addictome (P30 DA044223, 2017-2022)
  • NIA Translational Systems Genetics of Mitochondria, Metabolism, and Aging (R01AG043930, 2013-2018)
  • NIAAA Integrative Neuroscience Initiative on Alcoholism (U01 AA016662, U01 AA013499, U24 AA013513, U01 AA014425, 2006-2017)
  • NIDA, NIMH, and NIAAA (P20-DA 21131, 2001-2012)
  • NCI MMHCC (U01CA105417), NCRR, BIRN, (U24 RR021760)
    Join GeneNetwork Mailing List
    It took 0.114 second(s) for tux01.uthsc.edu to generate this page