|    Home    |    Search    |    Help    |    News    |    References    |    Policies    |    Links    |    Welcome! Login   

Probe Information

The table below lists information of all probes of probe set 1452010_at from database Eye M430v2 Probe (Sep08).

QTL Heat Map and ClusteringCorrelation Matrix and PCA

bl2seq3Exons4Tm °C5
Stacking Energy KBT6Mean7
Probe h29
Probe Location10SNPs
(Across all strains)
(Different alleles only between C57BL/6J and DBA/2J)
1 195437GCTATTGCCACCACCGTAGGGTAAA 84.08954.81343154.813455
3 616Y17ATTTCAGTGCCAACCTCACAAGAAG 80.99954.81339854.813422wt37-9-54813399
5 940487GAAGCTCCAGTTCTGAGTCTGTTGA 81.5954.81337754.813401wt37-9-54813399
7 884595GTTGATGCTGTGTTGTCCCTGTCTG 83.04954.81335754.813381
9 112375CTGTCTGCTCTGTCACCAGAAATCA 81.78954.81333954.813363
11 909597GTTGCCATGGTGATTGATCGCATTT 82.0954.81102154.811045
13 332987TTGATCGCATTTTTCTCTGGGTTTT 79.26954.81100854.811032
15 872709GGTTTTCATCCTGGTGTGCATTTTA 79.52954.81098954.811013wt37-9-54811004
17 970713GGATTATTTCTGCAACCCTTGATGG 79.43954.81095554.810979
19 324693GGGTTATTTTCCACTCATCTTGATC 76.81954.81080954.810833wt37-9-54810814
21 XX9285AATGAACATTTCACTATCCCCATGA 77.92954.8107254.810744

CITG Web services initiated January, 1994 as Portable Dictionary of the Mouse Genome; June 15, 2001 as WebQTL; and Jan 5, 2005 as GeneNetwork. This site is currently operated by Rob Williams, Pjotr Prins, Zachary Sloan, Arthur Centeno. Design and code by Pjotr Prins, Zach Sloan, Arthur Centeno, Danny Arends, Christian Fischer, Sam Ockman, Lei Yan, Xiaodong Zhou, Christian Fernandez, Ning Liu, Rudi Alberts, Elissa Chesler, Sujoy Roy, Evan G. Williams, Alexander G. Williams, Kenneth Manly, Jintao Wang, and Robert W. Williams, colleagues. Python Powered Registered with Nif
GeneNetwork support from:
  • The UT Center for Integrative and Translational Genomics
  • NIGMS Systems Genetics and Precision Medicine project (R01 GM123489, 2017-2021)
  • NIDA NIDA Core Center of Excellence in Transcriptomics, Systems Genetics, and the Addictome (P30 DA044223, 2017-2022)
  • NIA Translational Systems Genetics of Mitochondria, Metabolism, and Aging (R01AG043930, 2013-2018)
  • NIAAA Integrative Neuroscience Initiative on Alcoholism (U01 AA016662, U01 AA013499, U24 AA013513, U01 AA014425, 2006-2017)
  • NIDA, NIMH, and NIAAA (P20-DA 21131, 2001-2012)
  • NCI MMHCC (U01CA105417), NCRR, BIRN, (U24 RR021760)
    Join GeneNetwork Mailing List
    It took 0.196 second(s) for lily.uthsc.edu to generate this page